Kies je achtergrond: Kies je achtergrond: Registreer om je keuze te bewaren Sluiten
Forum Winkel Doneer
Huntington's Disease Youth Organization

Het Ziekte van Huntington Gen: Onder de microscoop

HDYO heeft meer informatie beschikbaar over de Ziekte van Huntington voor jongeren, ouders en professionals op onze website:

www.hdyo.org

De ZvH wordt veroorzaakt door een verlenging in één specifiek gen in iemands DNA. In dit artikel gaan we het uitgebreid hebben over dat bewuste gen en bekijken we deze ‘verlenging’. We zullen ook stambomen gebruiken om te laten zien hoe het gen overgeërfd en doorgegeven wordt.

Genen, chromosomen en DNA

DNA, chromosomes and genes

Laten we eerst eens enkele basisbegrippen bespreken, te beginnen bij DNA. DNA is de naam van de chemische stof waar onze genen van gemaakt zijn. De letters ‘DNA’ staan voor Deoxyribonucleic Acid (Deoxyribonucleinezuur, mooi woord, of niet?). Niet verwonderlijk dat niemand dat volledige woord ook echt gebruikt - DNA is een stuk makkelijker uit te spreken en te onthouden.

DNA is wat we erven van onze ouders en zij hebben hun DNA weer geërfd van hun ouders en zo verder. Ons DNA bepaalt wie we zijn, hoe we eruit zien en hoe we groeien. Dingen zoals onze haarkleur, oogkleur, lengte, of we man zijn of vrouw en zelfs aspecten van onze persoonlijkheid worden allemaal bepaald door ons DNA.

DNA is de naam van de chemische stof, maar genen zijn wat we de instructies noemen die in ons DNA zijn opgeslagen. We hebben een heleboel genen - ongeveer 23.000 om precies te zijn, in de cellen van ons lichaam. Elk gen is een set instructies - zoals een recept. Een gen vertelt de cel hoe het een chemische stof, genaamd eiwit maakt. Eiwitten zijn de machines die alle belangrijke dingen doen in onze cellen, van het in gang zetten van chemische reacties tot het overbrengen van boodschappen van de ene cel naar de andere.

Genen zitten aan elkaar, zoals een streng worstjes, en die zijn weer verpakt in dingen die we chromosomen noemen. Er zijn in totaal 46 chromosomen. Daarvan komen er 23 van je ene ouder en 23 van je andere ouder. In elke cel van je lichaam zit een kopie van alle 46 chromosomen.

Genetische veranderingen: het ZvH gen

Nu we de basisbegrippen kennen, kunnen we naar het ZvH gen gaan kijken. Soms ontstaan er veranderingen (wetenschappers noemen dat ‘mutaties’) in chromosomen of genen. Deze veranderingen kunnen de manier waarop je lichaam werkt veranderen en genetische ziekten veroorzaken. Zelfs een heel kleine verandering in het gen kan al een dramatische verandering in het eiwit veroorzaken. Stel je een recept voor dat aan de kok vertelt om een taart 400 minuten te bakken in plaats van 40 en je krijgt al een idee van hoe kleine spelfouten in onze genen grote problemen kunnen veroorzaken.

IN 1993 ONTDEKTE EEN GROEP WETENSCHAPPERS HET GEN dat verantwoordelijk is voor de Ziekte van Huntington op chromosoom 4. Zij vonden dat een deel van het gen zichzelf steeds weer herhaalde, zoals wanneer je stottert of wanneer je een toets op het toetsenbord van je computer te lang ingedrukt houuuuuuuuuuuuudt. Het is deze herhaling die de ontwikkeling van de Ziekte van Huntington veroorzaakt en is bekend onder de naam ‘CAG herhaling’.

Wat is een ‘CAG herhaling’?!

CAG repeats

Mocht je je afvragen waarom de stotter in het ZvH gen CAG repeat genoemd wordt en niet zoiets als ‘DNA’: het is een afkorting van een aantal ingewikkelde wetenschappelijke woorden. DNA is opgebouwd uit vier basen, die we kennen als adenine (afgekort als A), cytosine ©, guanine (G) en thymine (T). Deze basen zijn de code achter al ons DNA en onze genen. Elk gen heeft een andere code en, nou ja, wetenschappers zijn lui en hebben geen zin om steeds die hele ingewikkelde woorden voluit te schrijven, dus ze gebruiken alleen de afkortingen. Dus de vier DNA basen zijn bekend als A, C, G en T en als iemand een code voor een gen zou uitschrijven zou dat er ongeveer zo uitzien: AAGTCCTGACTGGGACCTTGAGA CCTAG.

Als een gen een soort recept is, dan zijn de basen de letters van het alfabet waarmee de instructies in het recept zijn geschreven. Genen gebruiken alleen een heel simpel alfabet met maar vier letters. Maar de spelling is net zo belangrijk.

Het gen dat de Ziekte van Huntington veroorzaakt bevat een deel waar de basen C, A en G heel vaak herhaald worden - de ‘CAG herhaling’. De meeste kopieën van het gen bevatten tussen de 10 en 20 herhalingen, maar soms wordt het aantal herhalingen groter en dan gaat het problemen geven.

CAG herhalingen

Iedereen heeft twee kopieën van het ZVH gen, of ze nu risico hebben om de ZvH te krijgen of niet. Van elke ouder hebben ze er één geërfd. En elk ZvH gen bevat een CAG herhaling in dat gen.

Wat nu de ontwikkeling van de ziekte veroorzaakt is het aantal CAG herhalingen. Eenvoudig gezegd, mensen die de ZvH krijgen hebben meer CAG herhalingen dan mensen die het niet krijgen. Om het wat makkelijker te maken zullen we het aantal CAG herhalingen opdelen in vier categorieën. Maar één van de kopieën van het gen hoeft maar verlengd te zijn om problemen te veroorzaken.

26 en lager (niet-aangedane categorie)

Zoals al gezegd, heeft iedereen een CAG herhaling in zijn ZvH genen (zelfs diegenen die niet uit een familie met de ZvH komen). De meeste mensen die niet de ZvH hebben, hebben ongeveer 10 tot 20 herhalingen. Feitelijk is alles tot 26 herhalingen prima en zal geen problemen geven. Maar als je daarboven komt, kan dat wel problemen geven.

40 herhalingen en meer (aangedane categorie)

Iedereen met 40 CAG herhalingen of meer zal, helaas, zeker de ZvH ontwikkelen tijdens zijn of haar leven, met 50% kans om dat gen ook aan elk van zijn of haar kinderen door te geven. De meeste mensen met de ZvH hebben 40 tot 50 CAG herhalingen.

Herhalingen in de midden categorie, tussen 27 en 39, zijn heel zeldzaam. Die zijn minder duidelijk en eigenlijk begrijpen wetenschappers ze niet goed. Daarom worden ze het ‘grijze gebied’ genoemd.

27-35 CAG herhalingen (risico voor toekomstige generaties)

Het goede nieuws bij een aantal herhalingen tussen de 27 en 35 is dat die persoon zelf de ZvH niet zal krijgen. Maar er is wel een klein risico (ongeveer 5%) dat de kinderen van die persoon risico lopen op het krijgen van de ZvH. Dat komt omdat herhalingen in deze categorie kunnen toenemen wanneer ze doorgegeven worden aan een kind. Soms neemt het zoveel toe dat het tot gevolg heeft dat een kind in de categorie belandt waarbij het wel de ZvH krijgt.

36-39 CAG herhalingen (beperkte penetrantie)

Mensen met herhalingen in deze categorie kunnen óf wel óf niet de ZvH krijgen. Mensen in deze categorie krijgen de ZvH mogelijk pas op latere leeftijd. Soms zo laat in hun leven dat ze al van ouderdom gestorven zijn, voordat ze symptomen ontwikkelen. Maar het risico dat ze de ziekte doorgeven aan hun kinderen is nog steeds 50%. Wetenschappers noemen deze onvoorspelbaarheid ‘beperkte penetrantie’.

Feit: CAG herhalingen zijn wat laboratoriummedewerkers tellen als mensen een GENETISCHE TEST doen voor de Ziekte van Huntington.

Het ‘verlengde’ Ziekte van Huntington gen Erven

Het komt hier op neer: als het ZvH gen teveel CAG herhalingen heeft, veroorzaakt het de Ziekte van Huntington. Laten we nu eens kijken naar hoe mensen dat verlengde gen erven en hoe de ZvH overgedragen kan worden binnen families.

Het 50% risico

50% risk

Mensen krijgen de ZvH door het verlengde gen te erven van een ouder. Omdat we een kopie van elk chromosoom erven van elke ouder, hebben we uiteindelijk twee kopieën van elk gen - één van moeder en één van vader.

Dus, iemand met de ZvH heeft twee kopieën van het ZvH gen, waarvan er één verlengd is (met veel CAG herhalingen) en een andere die normaal is.

Iemand zonder de ZvH heeft ook twee kopieën van het ZvH gen, maar die zijn allebei normaal.

Dus een kind met één ouder met de ZvH heeft één normaal gen van de gezonde ouder, maar kan ofwel het verlengde gen of het normale gen van de ouder met de ZvH hebben geërfd.

Dat maakt dat het risico dat je het verlengde gen hebt geërfd 50% is.

Technisch gezien zijn er vier mogelijke uitkomsten als het gaat om de genen die overgedragen zijn (zoals de illustratie laat zien). Twee van deze uitkomsten houden in dat het kind het verlengde gen heeft en de andere twee niet - dus de kans is 50%. Maar om het wat eenvoudiger te maken, kun je de ouder die de ZvH niet heeft buiten beschouwing laten en je alleen concentreren op de vraag of het kind het verlengde of het normale gen van de ouder met de ZvH erft. Ook dan is de kans nog steeds 50%.

Of iemand het verlengde of het normale gen erft is puur een kwestie van toeval, dat is ook waarom je mensen erover hoort spreken als over het opgooien van een muntje. Elk individu heeft ook zijn eigen 50% kans, dus het is alsof ieder zijn eigen muntje moet opgooien als het gaat om zijn eigen risico.

De 25% kans

25% grandchild risk

Voor sommigen is het echter zo dat het risico niet altijd simpelweg 50% is. Bijvoorbeeld: als de grootouder van een kind de ZvH heeft, maar de ouder van het kind die risico loopt heeft zich niet laten testen, dan heeft het kind een kans van 25% dat hij of zij het gen heet geërfd.

Dat is zo, omdat we niet weten of de ouder het verlengde gen heeft of niet. Als de ouder het verlengde gen had, zou het risico voor het kind 50% zijn.

Als de ouder het verlengde gen niet heeft, daalt het risico van 25% naar 0% - wat betekent dat er helemaal geen risico is voor het kind. Het hangt allemaal helemaal af van welke genen de ouder heeft geërfd. Totdat we dat weten, is het risico 25%.

Autosomaal dominant

Als iemand één verlengd gen heeft en één normaal gen, hoe kan het dan dat het verlengde gen de overhand neemt en de ZvH veroorzaakt? Waarom vecht dat normale gen niet terug? Nou, kijk daarvoor niet verder dan naar de term ‘autosomaal dominant’. Helaas is de ZvH wat we noemen een ‘autosomaal dominante ziekte’, wat betekent dat ook al is maar één van de twee genen verlengd, dat nog steeds genoeg is om de ziekte te krijgen. In andere woorden: het domineert het normale gen. Dat is waarom er maar één verlengd gen nodig is om de ziekte te veroorzaken, en niet twee.

Samenvattend hebben we in dit hoofdstuk uitgelegd dat het gen dat de ZvH veroorzaakt, is verlengd omdat het teveel ‘CAG herhalingen’ heeft en dat deze CAG herhalingen in vier categorieën worden onderverdeeld. We hebben gekeken naar het risico om de ZvH te erven en hoe dat werkt. En ondanks het gebruik van sommige ingewikkelde termen zoals ‘autosomaal dominant’ hebben we hopelijk meer duidelijkheid dan verwarring kunnen bieden. Als je desondanks nog vragen hebt, stel die dan gerust in de STEL EEN VRAAG sectie, waar experts je uitstekend antwoord kunnen geven, maar je kunt ook direct CONTACT OPNEMEN MET HDYO als je liever privé je vragen wilt stellen.